Work Files Saved Searches
   My Account                                                  Search:   Quick/Number   Boolean   Advanced       Help   


 The Delphion Integrated View

  Buy Now:   Buy PDF- 32pp  PDF  |   File History  |   Other choices   
  Tools:  Citation Link  |  Add to Work File:    
  View:  Expand Details   |  INPADOC   |  Jump to: 
 
 Email this to a friend  Email this to a friend 
       
Title: US4363877: Recombinant DNA transfer vectors
[ Derwent Title ]


Country: US United States of America

View Images High
Resolution

 Low
 Resolution

 
32 pages

 
Inventor: Goodman, Howard M.; San Francisco, CA
Shine, John; San Francisco, CA
Seeburg, Peter H.; San Francisco, CA

Assignee: The Regents of the University of California, Berkeley, CA
other patents from UNIVERSITY OF CALIFORNIA, THE REGENTS OF (599425) (approx. 4,840)
 News, Profiles, Stocks and More about this company

Published / Filed: 1982-12-14 / 1978-04-19

Application Number: US1978000897710

IPC Code: Advanced: A61K 38/27; C07H 21/00; C07H 21/02; C07K 14/575; C07K 14/61; C07K 14/62; C12N 15/00; C12N 15/09; C12N 15/10; C12P 19/34;
IPC-7: C12N 1/00; C12N 15/18;

ECLA Code: C07K14/575D; C07K14/61; C07K14/62; C12N15/10D;

U.S. Class: Current: 435/320.1; 435/069.4; 435/091.41; 435/849; 536/023.51; 930/010; 930/120;
Original: 435/317; 435/172; 435/068; 435/091; 435/849;

Field of Search: 435/172,317,820,68

Government Interest:     The Government has rights in this invention pursuant to Grants No. AM-18878 and CA 14026 awarded by the Department of Health, Education and Welfare.

Priority Number:
1978-04-19  US1978000897710

Abstract:     Recombinant DNA transfer vectors containing codons for human somatomammotropin and for human growth hormone.

Attorney, Agent or Firm: Keil & Witherspoon ;

Primary / Asst. Examiners: Tanenholtz, Alvin E.;

Maintenance Status: CC Certificate of Correction issued
B1 Re-examined

INPADOC Legal Status: Show legal status actions          Buy Now: Family Legal Status Report

       
Related Applications: Go to Result Set: 2 patent(s) that list this one as related
Application Number Filed Patent Pub. Date  Title
US1977000836218 1977-09-23       


       
Parent Case:     This application in a continuation-in-part of copending application, Ser. No. 836,218, filed Sept. 23, 1977 and now abandoned.

Family: Show 157 known family members

First Claim:
Show all 8 claims
What is claimed is:     1. A recombinant DNA transfer vector comprising codons for human chorionic somatomammotropin comprising the nucleotide sequence:
  • 5'-G GCL24 ATM25 GAK26 ACL27 TAK28 CAJ29 GAJ30 TTK31 GAJ32 GAJ33 ACL34 TAK35 ATM36 CCL37 AAJ38 GAK39 CAJ40 AAJ41 TAK42 QR43 S43 TTK44 X45 TY45 CAK46 GAK47 QR48 S48 CAJ49 ACL50 QR51 S51 TTK52 TGK53 TTK54 QR55 S55 GAK56 QR57 S57 ATM58 CCL59 ACL60 CCL61 QR62 S62 AAK63 ATGGAJ65 GAJ66 ACL67 CAJ68 CAJ69 AAJ70 QR71 S71 AAK72 X73 TY73 GAJ74 X75 TY75 X76 TY76 W77 GZ77 ATM78 QR79 S79 X80 TY80 X81 TY81 X82 TY82 ATM83 GAJ84 QR85 S85 TGGX87 TY87 GAJ88 CCL89 GTL90 W91 GZ91 TTK92 X93 TY93 W94 GZ94 QR95 S95 ATGTTK97 GCL98 AAK99 AAK100 X101 TY 101 GTL102 TAK103 GAK104 ACL105 QR106 S106 GAK107 QR108 S108 GAK109 GAK110 TAK111 CAK112 X113 TY113 X114 TY114 AAJ115 GAK116 X117 TY117 GAJ118 GAJ119 GGL120 ATM121 CAJ122 ACL123 X124 TY124 ATGGGL126 W127 GZ127 X128 TY128 GAJ129 GAK130 GGL131 QR132 S132 W133 GZ133 W134 GZ134 ACL135 GGL136 CAJ137 ATM138 X139 TY139 AAJ140 CAJ141 ACL142 TAK143 QR144 S144 AAJ145 TTK146 GAK147 ACL148 AAK149 QR150 S150 CAK151 AAK152 CAK153 GAK154 GCL155 X156 TY156 X157 TY157 AAJ158 AAK159 TAK160 GGL161 X162 TY162 X163 TY163 TAK164 TGK165 TTK166 W167 GZ167 AAJ168 GAK169 ATGGAK171 AAJ172 GTL173 GAJ174 ACL175 TTK176 X177 TY177 W178 GZ178 ATGGTL180 CAJ181 TGK182 W 183 GZ183 QR184 S184 GTL185 GAJ186 GGL187 QR188 S188 TGK189 GGL190 TTK191 TAGGTGCCCGAGTAGCATCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCC-3' wherein
    • A is deoxyadenyl,
    • G is deoxyguanyl,
    • C is deoxycytosyl,
    • T is thymidyl,
    • J is A or G;
    • K is T or C;
    • L is A,T,C or G;
    • M is A, C or T;
  • X is T or C, if the succeeding Y is A or G, and C if the succeeding Y is C or T;
  • Y is A, G, C or T, if the preceding X is C, and A or G if the preceding X is T;
  • W is C or A, if the succeeding Z is G or A, and C if the succeeding Z is C or T;
  • Z is A, G, C or T, if the preceding W is C, and A or G if the preceding W is A;
  • QR is TC, if the succeeding S is A, G, C or T, and AG if the succeeding S is T or C;
  • S is A, G, C or T, if the preceding QR is TC, and T or C if the preceding QR is AG and subscript numerals refer to the amino acid position in human growth hormone, for which the nucleotide sequence corresponds, according to the genetic code, the amino acid positions being numbered from the amino end.


Background / Summary: Show background / summary

Drawing Descriptions: Show drawing descriptions

Description: Show description

Forward References: Show 47 U.S. patent(s) that reference this one

       
U.S. References: Go to Result Set: All U.S. references   |  Forward references (47)   |   Backward references (0)   |   Citation Link

       
Foreign References: None

Other Abstract Info: CHEMABS 090(17)135003G DERABS C1978-80247A

Other References:
  • Seeburg et al., Nature 270, 486-494, (1977). (9 pages) Cited by 25 patents
  • Shine et al., Nature, 294-299, (1977).
  • Rodriguez et al., ICN-UCLA Symposium on Molecular and Genetic Biology Academic Press, (1976).
  • Tashjian et al., Endochrinology 82, 342-352, (1968).
  • Wallis et al., Growth Hormone and Related Peptides Ed Copecile et al., Elsevier, pp. 1-13, (1976).
  • Seeburg et al., Cell 12, 157-165, (1977). (9 pages) Cited by 4 patents
  • Dayhoff, Atlas of Protein Sequence and Structure 5, Suppl. 2, pp. 120-121, Wash., D.C. 1976.
  • Martial et al., Proc. Nat. Acad. Science U.S.A. 74, 1816-1820, (1977). (5 pages) Cited by 2 patents
  • Niall et al., Proc. Nat. Acad. Science, U.S.A. 68, 866-869, (1971). Cited by 2 patents
  • Roberts et al., Proc. Nat. Acad. Science U.S.A. 70, 2330-2334, (1973). (5 pages) Cited by 15 patents
  • Scheller et al., Science 196, 177-180, Apr. 1977.
  • Efstratiadis et al., Genetic Engineering, pp. 15-36, Edited by Setlow et al., Penum Press, New York, 1979.
  • Braverman, Methods in Enzymology, vol. XXX, Part F, pp. 605-612, (1974).
  • Bancroft et al., Proc. Nat. Acad. Sci. U.S.A. 70, 3646-3649, (1973). (4 pages) Cited by 3 patents
  • Ullrich et al., Science, vol. 196, pp. 1313-1319, Jun. 17, 1977.
  • Szostak et al., Methods in Enzymology, vol. 68, Recombinant DNA, pp. 419-428, (1979).


  • Inquire Regarding Licensing

    Powered by Verity


    Plaques from Patent Awards      Gallery of Obscure PatentsNominate this for the Gallery...

    Thomson Reuters Copyright © 1997-2013 Thomson Reuters 
    Subscriptions  |  Web Seminars  |  Privacy  |  Terms & Conditions  |  Site Map  |  Contact Us  |  Help